Why does the Wuhan coronavirus genome end in 33 A’s?

https://bioinformatics.stackexchange.com/questions/11227/why-does-the-wuhan-coronavirus-genome-end-in-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

by jamiesonbecker • 6 years ago

163 51 6 years ago

bioinformatics.stackexchange.com

sarosh• 6 years ago

Apparently: "poly(A) tails at the 3' end of RNA are not an unusual feature of viruses. Eukaryotic mRNA almost always contains poly(A) tails, which are added post-transcriptionally in a process known as polyadenylation. It should not therefore be surprising that positive-strand RNA viruses would have poly(A) tails as well. In eukaryotic mRNA, the central sequence motif for identifying a polyadenylation region is AAUAAA, identified way back in the 1970s, with more recent research confirming its ubiquity. Proudfoot 2011 is a nice review article on poly(A) signals in eukaryotic mRNA."

Edit: A more recent (2017) study than Proudfoot 2011 offers the perspective that the process may be more tissue specific. From Tian B., Manley J.L. Alternative polyadenylation of mRNA precursors. Nat. Rev. Mol. Cell Biol. 2016; 18:18–30:

Alternative polyadenylation (APA) is an RNA-processing mechanism that generates distinct 3′ termini on mRNAs and other RNA polymerase II transcripts. It is widespread across all eukaryotic species and is recognized as a major mechanism of gene regulation. APA exhibits tissue specificity and is important for cell proliferation and differentiation. In this Review, we discuss the roles of APA in diverse cellular processes, including mRNA metabolism, protein diversification and protein localization, and more generally in gene regulation. We also discuss the molecular mechanisms underlying APA, such as variation in the concentration of core processing factors and RNA-binding proteins, as well as transcription-based regulation.

sincerely• 6 years ago

Yup, that's what the link says

bittercynic• 6 years ago

Seems like this is a strategy for making an article appear more relevant to current events than it really is.

popcorncolonel• 6 years ago

What's the point of this comment? Isn't this pretty much exactly what's in the answer linked?

Yetanfou• 6 years ago

The generally accepted term for this type of comment is "karma whoring", an attempt to garner upvotes for the erudite and enlightening explanation of the phenomenon by quoting the article itself. This works for those who suffer from 'TL,DR' but it fails on those who actually read before they comment.

seibelj• 6 years ago

No one has proven that this virus is any more deadly than a bad flu. 3-4% of hospitalized cases is not absurd compared to the yearly flu. Very interesting, all of this

uwuhn• 6 years ago

Do you think the Chinese governments (provincial and central) are overreacting then?

newnewpdro2• 6 years ago

I think they might be deliberately using it as a fire drill, which seems like a good idea considering the size of their population.

Taniwha• 6 years ago

a bad flu can kill millions

https://en.wikipedia.org/wiki/Spanish_flu

ghostpepper2• 6 years ago

The CDC has a page up right now showing a 7% mortality rate for influenza on a weekly basis.

https://www.cdc.gov/flu/weekly/index.htm

legolas2412• 6 years ago

"The percentage of deaths attributed to pneumonia and influenza decreased from 7.1% to 6.7% and is below the epidemic threshold."

That's not mortality rate. You make it sound like 7% of those with flu will die. Instead it means that 7% of deaths are because of flu and pneumonia, which still seems high to me though

feral• 6 years ago

That says 7 percent of deaths are from influenza, not that 7 percent of people with influenza die.

topmonk3• 6 years ago

Don't trust China's government figures.

koheripbal2• 6 years ago

There are many social media reports of dead patients not being included in the official tallies.

You cannot trust Chinese gov't numbers.

eat_veggies2• 6 years ago

PKCS#7 padding

jmspring• 6 years ago

upvoted, but I hate you for the PTSD the PKCS standards trigger :)

TrueDuality• 6 years ago

It blows my mind that we're at a stage of scientific exchange where this kind of discourse and genetic information is so readily available at people's fingertips.

blazespin3• 6 years ago

Quite frightening, really, given CRISPR. It's like discussing optimal ways to build a thermonuclear bomb in your kitchen casually in an open, public forum.

ars• 6 years ago

Any lab capable of building a dangerous virus already had that capability before this open info.

Your thermonuclear bomb example was pretty apt: It's actually pretty easy to find out how, it's hard to actually do it.

anonymfus• 6 years ago

Why CRISPR is relevant here? I thought that synthesizing long DNA/RNA sequences (29903 base pairs here) was a practical limitation for creating bioweapons at home.

userbinator3• 6 years ago

It's surprisingly reminiscent of the "leader" and "trailer" of tape and film, and according to the quotes in the link, are required for the transcription process that "reads" the genome. The analogous functionality of reading a genome, and that of a human-made device reading tape or film, is fascinating.

0x8BADF00D• 6 years ago

It is interesting. DNA itself could be analogous to the tape that a Turing machine reads one cell at a time. The alphabet in each cell is finite (ATCG).

cliqueiq• 6 years ago

Not a biologist but the whole thing reminded me of a NOP sled

40acres• 6 years ago

While it's amazing that folks can simply discuss this on the internet I would love a ELI5 style answer so us simple folk could understand.

userbinator3• 6 years ago

It's essentially a "padding" that makes it easier for the biological machinery to read the genome.

0xdada• 6 years ago

So like a NOP sled?

voldacar• 6 years ago

The very first nCoV genome sequencied earlier this month[0] ends with 33 As, while the genome of the virus found in the first U.S. patient[1] ends with only 12 As.

Is it normal for there to be variation here? Do these repeated A sequences actually code for a protein or are they just a marker to let the ribosome know it's reached the end of the genome, and so the length of repeating As doesn't really matter past a certain point?

(I'm obviously not a biologist)

[0]https://www.ncbi.nlm.nih.gov/nuccore/MN908947

[1]https://www.ncbi.nlm.nih.gov/nuccore/MN985325

CrazyStat• 6 years ago

One of the papers mentioned in the linked discussion shows that the number of As can vary over time within a single patient. There seems to be some evidence that different lengths might give an advantage or disadvantage in replication, but it seems like variation is normal.

(also not a biologist, though I work with some)

epistasis• 6 years ago

It's times like these that we come to depend heavily on basic science, that up until now few would have realized is really important. There's a long chain of publications cited in the top answer, that all represent years of person hours trying to discover these behaviors and then share them with the world.

Politicians sometimes ridicule basic research in an attempt to claim that government is irresponsible, and during recent elections it would have been a simple thing to ridicule the idea of studying "how many As are at the end of a viral genome" as an egregious waste of tax funds. Yet here we are.

Basic science without any known applications are how the really big discoveries come about. Sometimes we can guess that an area will be fruitful, but it's now always the case.

Next time somebody attempts to ridicule science as pointless, think back to why anybody might care about a strange pattern of nucleotides at the end of a virus.

throwawayhhakdl• 6 years ago

I’ll be honest. I don’t feel like studying viral genome patterns is high on anyone’s list of useless science.

My second thought is that the observation of an unnatural pattern would be really important. Naively an early hypothesis might be the something that looks unnatural is man made.

GarrisonPrime• 6 years ago

For every 1 such study that ultimately proves useful, I wouldn’t be surprised if 100 (or even 1,000) were an utter waste of time.

Your argument seems to imply a shopaholic hoarder isn’t wasting their lives, just so long as at least sometimes they actually use a random rubber band or a ‘70’s themed valentine card.

asdff• 6 years ago

If that's the hitrate, then so be it. How many hours poured over code end up being useful?

sunstone• 6 years ago

It has a halting problem.

rambojazz• 6 years ago

I don't think that's just random

Why would he expect aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to be less random than for example acatgagacgtctaatgttagacatgcatgac?

koheripbal2• 6 years ago

While intuitively my instinct is to say "well, of course it's not random", but statistically, I don't know how to explain it...

userbinator3• 6 years ago

https://en.wikipedia.org/wiki/Entropy_(information_theory)

eat_veggies2• 6 years ago

I would bet that 99+% of arrangements of 33 letters "look random" -- that is, there is no discernible pattern. Despite each arrangement having an equally tiny probability of occurring, if you randomly generate an arrangement, you're all but guaranteed to get something that looks random.

For aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to appear, it is either an amazing coincidence, or there must be some non-random mechanism that creates it.

zippoxer• 6 years ago

If I had to guess, the chance for a sequence of 33 identical DNA letters would be (1/4 ^ 33) * 33

Pardon my math.

dwild• 6 years ago

Why would he expect aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa to be less random than for example acatgagacgtctaatgttagacatgcatgac?

Can we really consider any part of a genome random? I means your second example isn't part of it, so I guess it's "random" but if you compare any part, it would come from evolution and without this, the virus wouldn't survive most probably (or at least, not like it does currently).

What makes special aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa is that it's a pattern that we can spot easily. I'm pretty sure that any other patterns would make us curious about whether it's important or not. It seems like something that is graspable.

Why does the Wuhan coronavirus genome end in 33 A’s?

Related Stories